pEvol sfGFP WT
(Plasmid
#253740)
-
PurposeWT reporter plasmid
-
Depositing Lab
-
Depositing OrganizationBoston College
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253740 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonep15A ori
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesfGFP
-
Insert Size (bp)741
- Promoter T5-lac
-
Tag
/ Fusion Protein
- 6xHis tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gatctcgacgctctcccttatgcgac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEvol sfGFP WT was a gift from Abhishek Chatterjee (Addgene plasmid # 253740 ; http://n2t.net/addgene:253740 ; RRID:Addgene_253740) -
For your References section:
A Translation-Independent Directed Evolution Strategy to Engineer Aminoacyl-tRNA Synthetases. Soni C, Prywes N, Hall M, Nair MA, Savage DF, Schepartz A, Chatterjee A. ACS Cent Sci. 2024 May 20;10(6):1211-1220. doi: 10.1021/acscentsci.3c01557. eCollection 2024 Jun 26. 10.1021/acscentsci.3c01557 PubMed 38947215