Skip to main content

pZac2.1 gfaABC1D-ARL13B-BioID2-BioID2-HA
(Plasmid #253927)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253927 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pZac2.1
  • Backbone manufacturer
    Khakh lab
  • Backbone size w/o insert (bp) 5097
  • Total vector size (bp) 7920
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ARL13B-BioID2-BioID2-HA
  • Alt name
    ADP-ribosylation factor-like protein 13B
  • Alt name
    BioID2
  • Species
    H. sapiens (human); Aquifex aeolicus
  • Insert Size (bp)
    2823
  • GenBank ID
    NM_001174150
  • Entrez Gene
    ARL13B (a.k.a. ARL2L1, JBTS8)
  • Promoter gfaABC1D
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer taatacgactcactatagg
  • 3′ sequencing primer gtggtttgtccaaactcatc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Paul DeCaen; ARL13B was cloned from Addgene plasmid #232880.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZac2.1 gfaABC1D-ARL13B-BioID2-BioID2-HA was a gift from Baljit Khakh (Addgene plasmid # 253927 ; http://n2t.net/addgene:253927 ; RRID:Addgene_253927)
  • For your References section:

    Amygdala astrocyte primary cilium mechanisms contribute to stress behaviours. Pelaz SG, Mitsui K, Kolosowska N, Fritch H, Neupane C, Casha VH, Alonso-Gardon M, Pandey V, Wang L, Kawaguchi R, Wohlschlegel JA, Guo J, McCarroll SA, Berretta S, Khakh BS. Nature. 2026 Aug 5. doi: 10.1038/s41586-026-10874-0. 10.1038/s41586-026-10874-0 PubMed 42557328