pLKO-shFKBP8#2380
(Plasmid
#253963)
-
PurposeLentiviral shRNA-mediated knockdown of mouse FKBP8
-
Depositing Lab
-
Depositing OrganizationThe University of Tokyo
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253963 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLKO
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFkbp8
-
gRNA/shRNA sequenceCCGGGCTCTCAAAGCTGGTAAAGAACTCGAGTTCTTTACCAGCTTTGAGAGCTTTTT
-
SpeciesM. musculus (mouse)
-
Entrez GeneFkbp8 (a.k.a. 38kDa, FKBP-38, FKBP-8, FKBPR38, Fkbp38, mFKBP38)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-shFKBP8#2380 was a gift from Yusuke Hirabayashi (Addgene plasmid # 253963 ; http://n2t.net/addgene:253963 ; RRID:Addgene_253963) -
For your References section:
Mitochondrial complexity is regulated at ER-mitochondria contact sites via PDZD8-FKBP8 tethering. Nakamura K, Aoyama-Ishiwatari S, Nagao T, Paaran M, Obara CJ, Sakurai-Saito Y, Johnston J, Du Y, Suga S, Tsuboi M, Nakakido M, Tsumoto K, Kishi Y, Gotoh Y, Kwak C, Rhee HW, Seo JK, Kosako H, Potter C, Carragher B, Lippincott-Schwartz J, Polleux F, Hirabayashi Y. Nat Commun. 2025 Apr 17;16(1):3401. doi: 10.1038/s41467-025-58538-3. 10.1038/s41467-025-58538-3 PubMed 40246839