Skip to main content

pLKO-shFKBP8#2380
(Plasmid #253963)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253963 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fkbp8
  • gRNA/shRNA sequence
    CCGGGCTCTCAAAGCTGGTAAAGAACTCGAGTTCTTTACCAGCTTTGAGAGCTTTTT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Fkbp8 (a.k.a. 38kDa, FKBP-38, FKBP-8, FKBPR38, Fkbp38, mFKBP38)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-shFKBP8#2380 was a gift from Yusuke Hirabayashi (Addgene plasmid # 253963 ; http://n2t.net/addgene:253963 ; RRID:Addgene_253963)
  • For your References section:

    Mitochondrial complexity is regulated at ER-mitochondria contact sites via PDZD8-FKBP8 tethering. Nakamura K, Aoyama-Ishiwatari S, Nagao T, Paaran M, Obara CJ, Sakurai-Saito Y, Johnston J, Du Y, Suga S, Tsuboi M, Nakakido M, Tsumoto K, Kishi Y, Gotoh Y, Kwak C, Rhee HW, Seo JK, Kosako H, Potter C, Carragher B, Lippincott-Schwartz J, Polleux F, Hirabayashi Y. Nat Commun. 2025 Apr 17;16(1):3401. doi: 10.1038/s41467-025-58538-3. 10.1038/s41467-025-58538-3 PubMed 40246839