px459ver2.0-FKBP8-gRNA1 (for mouse)
(Plasmid
#253968)
-
PurposeCRISPR/Cas9 (PX459) plasmid expressing gRNA N-terminal knock-in of mouse Fkbp8.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253968 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePX459
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFkbp8
-
gRNA/shRNA sequenceAGTTCCTGATCCCAGCAGCA
-
SpeciesM. musculus (mouse)
-
Entrez GeneFkbp8 (a.k.a. 38kDa, FKBP-38, FKBP-8, FKBPR38, Fkbp38, mFKBP38)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px459ver2.0-FKBP8-gRNA1 (for mouse) was a gift from Yusuke Hirabayashi (Addgene plasmid # 253968 ; http://n2t.net/addgene:253968 ; RRID:Addgene_253968) -
For your References section:
Mitochondrial complexity is regulated at ER-mitochondria contact sites via PDZD8-FKBP8 tethering. Nakamura K, Aoyama-Ishiwatari S, Nagao T, Paaran M, Obara CJ, Sakurai-Saito Y, Johnston J, Du Y, Suga S, Tsuboi M, Nakakido M, Tsumoto K, Kishi Y, Gotoh Y, Kwak C, Rhee HW, Seo JK, Kosako H, Potter C, Carragher B, Lippincott-Schwartz J, Polleux F, Hirabayashi Y. Nat Commun. 2025 Apr 17;16(1):3401. doi: 10.1038/s41467-025-58538-3. 10.1038/s41467-025-58538-3 PubMed 40246839