pMUT1-pTlpA-csgAwt
(Plasmid
#254238)
-
PurposepMUT1 vector native to E. coli Nissle 1917 with ampicillin resistance and temperature sensitive wild-type curli expression
-
Depositing Lab
-
Depositing OrganizationNortheastern University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254238 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMUT1
-
Backbone manufacturerNative to E. coli Nissle 1917
- Total vector size (bp) 9965
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Mach1
-
Growth instructionsMach1 E. coli may also be used for transformation
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynthetic curli operon with temperature-sensitive (TlpA) regulation
-
SpeciesSynthetic
-
Insert Size (bp)4733
- Promoter pTlpA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cattactcgcatccattctcaggc
- 3′ sequencing primer cctgggattgcagccgcagcaggt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMUT1-pTlpA-csgAwt was a gift from Neel Joshi (Addgene plasmid # 254238 ; http://n2t.net/addgene:254238 ; RRID:Addgene_254238)