pLKO.1-deltaU6-tRNA-Phe(GAA) 1-4
(Plasmid
#254428)
-
PurposeMammalian expression plasmid encoding human tRNA-Phe(GAA) isodecoder 1-4.
-
Depositing Lab
-
Depositing OrganizationBeckman Research Institute of the City of Hope
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254428 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerBob Weinberg, Addgene Plasmid #8453
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametRNA-Phe (anticodon GAA) 1-4
-
Alt nameTRNAF2
-
Alt nameTRF-GAA1-2
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGAGGTCGAGAATTCGCATCAACAAATGTGCATTTGAGAC
- 3′ sequencing primer GGCCGCCCCCTTCACCTGAGAAACCCGAGCTCTGAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-deltaU6-tRNA-Phe(GAA) 1-4 was a gift from Rui Su (Addgene plasmid # 254428 ; http://n2t.net/addgene:254428 ; RRID:Addgene_254428) -
For your References section:
Targeting the METTL1/m7G axis as a therapeutic strategy in myeloid leukemia. Ren L, Zhang H, Bobileva O, Nai F, Bi H, Chan A, Baker GE, Dong L, Guarin D, Hu W, Li W, Leite I, Wang X, Zhang X, Xue M, Wang H, Qin H, Wu X, Ghoda L, Xu L, Zhang B, Li L, Wunderlich M, Mulloy JC, Jones CL, O'Leary SE, Li H, Rosen ST, Chen CD, Heisterkamp N, Perry JJP, Nam Y, Chen J, Caflisch A, Li X, Su R. Blood. 2026 Jun 18;147(25):3069-3085. doi: 10.1182/blood.2025030336. 10.1182/blood.2025030336 PubMed 42247311