iAAV-TnnT2-GFP
(Plasmid
#254458)
-
PurposeExpresses GFP upon Dox induction specifically in TnT2 promoter active cardiomyocytes.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254458 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAAV9
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
-
SpeciesSynthetic
-
Entrez Genegfp (a.k.a. pCmGFP_001)
- Promoter TRE
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccaactttccgtaccacttcc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
iAAV-TnnT2-GFP was a gift from Miao Cui (Addgene plasmid # 254458 ; http://n2t.net/addgene:254458 ; RRID:Addgene_254458)
Map uploaded by the depositor.
