pAAV_TRE3G-NTVE(PABP)
(Plasmid
#254464)
-
PurposeAAV transfer vector encoding TRE3G-driven NTVE(PABP) with a surface FLAG epitope tag. Requires co-transduction with AAVs expressing rtTA (e.g., Tet-On 3G) or tTA for dox-dependent expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254464 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV
-
Vector typeAAV, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNTVE(PABP)_P2A_eUnaG2_P2A_GlycophorinA-FLAG
-
SpeciesSynthetic
- Promoter TRE3G
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAACGTATAAGCTTTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.11.11.622832 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_TRE3G-NTVE(PABP) was a gift from Gil Westmeyer (Addgene plasmid # 254464 ; http://n2t.net/addgene:254464 ; RRID:Addgene_254464) -
For your References section:
Non-destructive transcriptomics via vesicular export. Armbrust N, Grosshauser M, Geilenkeuser J, Stroppel L, Jozinovic M, Levermann H, Panne T, Wissmann J, Goelitz L, Schmidt S, Orschmann T, Rusha E, Steinmassl E, Widenmeyer F, Warsing N, Sabry M, Sultanbai A, Santl T, Geerlof A, Berezin O, Bodea SV, Moretti A, Schneider S, Theis F, Gagneur J, Truong DJ, Westmeyer GG. Nat Commun. 2026 Apr 25;17(1):3812. doi: 10.1038/s41467-026-72072-w. 10.1038/s41467-026-72072-w PubMed 42034633