pMSL88
(Plasmid
#254505)
-
PurposeExpresses Type IV-A1 Cas5,6,7,8, Repeat-Spacer-Repeat CRISPR-RNA, and CasDinG-HNH from Pseudomonas oleovorans. CasDinG was engineered to include a C-terminal HNH nuclease domain
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254505 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRSFDuet™-1
-
Backbone manufacturerSnapGene
- Backbone size w/o insert (bp) 3829
- Total vector size (bp) 9588
-
Modifications to backboneMCS-1: Cas6, Cas8, Cas7, Cas5 MCS-2: Repeat-Spacer-Repeat, CasDinG-HNH
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCas6
-
Alt namecsf5
-
SpeciesPseudomonas oleovorans
-
Insert Size (bp)711
-
GenBank ID
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GGATCTCGACGCTCTCCCT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCas8
-
Alt namecsf1
-
SpeciesPseudomonas oleovorans
-
Insert Size (bp)724
-
GenBank ID
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGAAGCATAACCCTAACTC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCas7
-
Alt namecsf2
-
SpeciesPseudomonas oleovorans
-
Insert Size (bp)1043
-
GenBank ID
- Promoter T7
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGTTTCTGCTGAATATCACTCCAG
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameCas5
-
Alt namecsf3
-
Insert Size (bp)668
-
GenBank ID
- Promoter T7
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTCCGGTCAAGCTACTGAG
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameCRISPR-RNA
-
Alt nameRepeat-Spacer-Repeat
-
SpeciesPseudomonas oleovorans
-
Insert Size (bp)90
-
GenBank ID
- Promoter T7
Cloning Information for Gene/Insert 5
- Cloning method Gibson Cloning
- 5′ sequencing primer GAAATAATTTTGTTTAACTTTAATA
- (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert nameCasDinG-HNH
-
Alt namecsf4
-
SpeciesPseudomonas oleovorans
-
Insert Size (bp)2493
-
GenBank ID
- Promoter T7
-
Tag
/ Fusion Protein
- HNH domain (C terminal on insert)
Cloning Information for Gene/Insert 6
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGTACACGGCCGCATAATC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
All-in-one plasmid expressing:
- Type IV-AI Cas5,6,7,8
- Repeat-Spacer-Repeat CRISPR-RNA (Filler spacer can be exchanged by BseRI golden gate cloning for desired target RNA)
- CasDinG-HNH
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSL88 was a gift from Lennart Randau (Addgene plasmid # 254505 ; http://n2t.net/addgene:254505 ; RRID:Addgene_254505) -
For your References section:
Type I-Fv and engineered type IV-A1 CRISPR-Cas effectors facilitate genome reduction in Escherichia coli. Klein N, Sanchez-Londono M, Kara MM, Gomes-Filho JV, Novak S, Kholeif KH, Pekarek L, Caliskan N, Randau L. Nucleic Acids Res. 2025 Nov 26;53(22):gkaf1399. doi: 10.1093/nar/gkaf1399. 10.1093/nar/gkaf1399 PubMed 41414667