Skip to main content

pLenti_Cas9_GFP_CDK9_sg1
(Plasmid #254537)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254537 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    Lenti spCas9 gRNA GFP (Addgene #124770)
  • Backbone manufacturer
    Jason Sheltzer
  • Backbone size w/o insert (bp) 13204
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CDK9
  • Alt name
    spCas9
  • gRNA/shRNA sequence
    CCAGAGTGTCACCACACGGT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    CDK9 (a.k.a. C-2k, CDC2L4, CTK1, PITALRE, TAK)
  • Tags / Fusion Proteins
    • FLAG-SV40NLS (N terminal on insert)
    • nucleoplasminNLS-P2A-GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

spCas9 has FLAG-SV40NLS and nucleoplasmin NLS-P2A-GFP

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti_Cas9_GFP_CDK9_sg1 was a gift from Jason Sheltzer (Addgene plasmid # 254537 ; http://n2t.net/addgene:254537 ; RRID:Addgene_254537)
  • For your References section:

    Paired CRISPR screens identify mitochondrial metabolism and UBE2H as aneuploid-specific dependencies in human cancer cell lines. Klaske M. Schukken, Saron M. Akalu, Charles Zou, Pranav K. Kandikuppa, Ryan A. Hagenson, Jessica L. Keane, Mason P. Lynch, Toyoki Yoshimoto, Olaf Klingbeil, Erin L. Sausville, Sanat Mishra, Christopher R. Vakoc, Zuzana Storchova, Sarah J. Aitken, Jason M. Sheltzer. bioRxiv 2026.04.26.720636 10.64898/2026.04.26.720636