pLenti_Cas9_GFP_CDK9_sg4
(Plasmid
#254540)
-
PurposeCDK9 knockout
-
Depositing Lab
-
Depositing OrganizationYale University
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254540 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLenti spCas9 gRNA GFP (Addgene #124770)
-
Backbone manufacturerJason Sheltzer
- Backbone size w/o insert (bp) 13204
-
Vector typeLentiviral, CRISPR
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCDK9
-
Alt namespCas9
-
gRNA/shRNA sequenceGCTGACTGATGAGGGCGAGT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneCDK9 (a.k.a. C-2k, CDC2L4, CTK1, PITALRE, TAK)
-
Tags
/ Fusion Proteins
- FLAG-SV40NLS (N terminal on insert)
- nucleoplasminNLS-P2A-GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
spCas9 has FLAG-SV40NLS and nucleoplasmin NLS-P2A-GFP
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti_Cas9_GFP_CDK9_sg4 was a gift from Jason Sheltzer (Addgene plasmid # 254540 ; http://n2t.net/addgene:254540 ; RRID:Addgene_254540) -
For your References section:
Paired CRISPR screens identify mitochondrial metabolism and UBE2H as aneuploid-specific dependencies in human cancer cell lines. Klaske M. Schukken, Saron M. Akalu, Charles Zou, Pranav K. Kandikuppa, Ryan A. Hagenson, Jessica L. Keane, Mason P. Lynch, Toyoki Yoshimoto, Olaf Klingbeil, Erin L. Sausville, Sanat Mishra, Christopher R. Vakoc, Zuzana Storchova, Sarah J. Aitken, Jason M. Sheltzer. bioRxiv 2026.04.26.720636 10.64898/2026.04.26.720636