Skip to main content
Addgene
Open Menu

FRET-OFF
(Plasmid #254590)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254590 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pLenti CMV Neo DEST
  • Backbone manufacturer
    Eric Campeau Lab (Addgene Plasmid #17392)
  • Total vector size (bp) 10054
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FRET-OFF
  • Species
    Synthetic
  • Insert Size (bp)
    1896
  • Mutation
    deleted Histone H3 from H3K9me3(W45A) biosensor
  • Promoter CMV
  • Tags / Fusion Proteins
    • YPet (N terminal on insert)
    • ECFP (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    FRET-OFF was based the W45A mutant of H3K9me3 biosensor, a gift from Yingxiao Wang (Addgene plasmid # 120808 ; http://n2t.net/addgene:120808 ; RRID:Addgene_120808).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FRET-OFF was a gift from Chuan-Hsiang Huang (Addgene plasmid # 254590 ; http://n2t.net/addgene:254590 ; RRID:Addgene_254590)

  • For your References section:

    Robust calibration and quantification of FRET signals using multiplexed biosensor barcoding. Wu JW, Yang JM, Chen CC, Au G, Wang S, Xu Y, Chern GW, Huang CH. iScience. 2025 Oct 11;28(11):113743. doi: 10.1016/j.isci.2025.113743. eCollection 2025 Nov 21. 10.1016/j.isci.2025.113743 PubMed 41210971
Related items: