FRET-OFF
(Plasmid
#254590)
-
PurposeEngineered low-FRET standard for FRET ratio calibration
-
Depositing Lab
-
Depositing OrganizationJohns Hopkins University and School of Medicine
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254590 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti CMV Neo DEST
-
Backbone manufacturerEric Campeau Lab (Addgene Plasmid #17392)
- Total vector size (bp) 10054
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFRET-OFF
-
SpeciesSynthetic
-
Insert Size (bp)1896
-
Mutationdeleted Histone H3 from H3K9me3(W45A) biosensor
- Promoter CMV
-
Tags
/ Fusion Proteins
- YPet (N terminal on insert)
- ECFP (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFRET-OFF was based the W45A mutant of H3K9me3 biosensor, a gift from Yingxiao Wang (Addgene plasmid # 120808 ; http://n2t.net/addgene:120808 ; RRID:Addgene_120808).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FRET-OFF was a gift from Chuan-Hsiang Huang (Addgene plasmid # 254590 ; http://n2t.net/addgene:254590 ; RRID:Addgene_254590) -
For your References section:
Robust calibration and quantification of FRET signals using multiplexed biosensor barcoding. Wu JW, Yang JM, Chen CC, Au G, Wang S, Xu Y, Chern GW, Huang CH. iScience. 2025 Oct 11;28(11):113743. doi: 10.1016/j.isci.2025.113743. eCollection 2025 Nov 21. 10.1016/j.isci.2025.113743 PubMed 41210971