Skip to main content

FRET-ON
(Plasmid #254591)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254591 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLenti CMV Neo DEST
  • Backbone manufacturer
    Eric Campeau Lab (Addgene Plasmid #17392)
  • Total vector size (bp) 9943
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FRET-ON
  • Alt name
    cytosolic FAK(Y349F)
  • Species
    Synthetic
  • Insert Size (bp)
    1785
  • Mutation
    Y349F
  • Promoter CMV
  • Tags / Fusion Proteins
    • ECFP (N terminal on insert)
    • YPet (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    FRET-ON was based on the cytosolic FAK biosensor, a gift from Yingxiao Wang (Addgene plasmid # 78300 ; http://n2t.net/addgene:78300 ; RRID:Addgene_78300).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FRET-ON was a gift from Chuan-Hsiang Huang (Addgene plasmid # 254591 ; http://n2t.net/addgene:254591 ; RRID:Addgene_254591)
  • For your References section:

    Robust calibration and quantification of FRET signals using multiplexed biosensor barcoding. Wu JW, Yang JM, Chen CC, Au G, Wang S, Xu Y, Chern GW, Huang CH. iScience. 2025 Oct 11;28(11):113743. doi: 10.1016/j.isci.2025.113743. eCollection 2025 Nov 21. 10.1016/j.isci.2025.113743 PubMed 41210971