Skip to main content

EKAR1
(Plasmid #254592)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254592 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLenti CMV Neo DEST
  • Backbone manufacturer
    Eric Campeau Lab (Addgene Plasmid #17392)
  • Total vector size (bp) 10162
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EKAR1
  • Species
    Synthetic
  • Insert Size (bp)
    2004
  • Promoter CMV
  • Tags / Fusion Proteins
    • ECFP (N terminal on insert)
    • YPet (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EKAR1 was a gift from Chuan-Hsiang Huang (Addgene plasmid # 254592 ; http://n2t.net/addgene:254592 ; RRID:Addgene_254592)
  • For your References section:

    Robust calibration and quantification of FRET signals using multiplexed biosensor barcoding. Wu JW, Yang JM, Chen CC, Au G, Wang S, Xu Y, Chern GW, Huang CH. iScience. 2025 Oct 11;28(11):113743. doi: 10.1016/j.isci.2025.113743. eCollection 2025 Nov 21. 10.1016/j.isci.2025.113743 PubMed 41210971