EKAR1
(Plasmid
#254592)
-
PurposeERK activity reporter with ECFP-YPet FRET pair
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti CMV Neo DEST
-
Backbone manufacturerEric Campeau Lab (Addgene Plasmid #17392)
- Total vector size (bp) 10162
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEKAR1
-
SpeciesSynthetic
-
Insert Size (bp)2004
- Promoter CMV
-
Tags
/ Fusion Proteins
- ECFP (N terminal on insert)
- YPet (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EKAR1 was a gift from Chuan-Hsiang Huang (Addgene plasmid # 254592 ; http://n2t.net/addgene:254592 ; RRID:Addgene_254592) -
For your References section:
Robust calibration and quantification of FRET signals using multiplexed biosensor barcoding. Wu JW, Yang JM, Chen CC, Au G, Wang S, Xu Y, Chern GW, Huang CH. iScience. 2025 Oct 11;28(11):113743. doi: 10.1016/j.isci.2025.113743. eCollection 2025 Nov 21. 10.1016/j.isci.2025.113743 PubMed 41210971