pVL019
(Plasmid
#254598)
-
PurposeEncodes a 0.8 kb bacterial transcription unit with Spirochaeta africana P-pori promoter and Broccoli-tRNA fluorogenic aptamer shortly upstream of the intrinsic terminator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254598 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepOA-RQ
-
Backbone manufacturerGeneArt (Thermo Fisher Scientific)
- Backbone size w/o insert (bp) 2414
- Total vector size (bp) 3392
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBacterial transcription unit encoding P-pori promoter and Broccoli-tRNA fluorogenic aptamer
-
SpeciesSynthetic
-
Insert Size (bp)978
- Promoter P-pori
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- 3′ sequencing primer GAAACAGCTATGACCATGTTAATGCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.02.09.704077 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVL019 was a gift from Georgi Belogurov (Addgene plasmid # 254598 ; http://n2t.net/addgene:254598 ; RRID:Addgene_254598) -
For your References section:
Regulatory landscapes and structural choreography of transcription initiation in spirochetes. Trapp VK, Wang T, Hilal T, Makinen JJ, Kotikoski J, Tavi PJ, Levola V, Paavilainen S, Loll B, Wahl MC, Belogurov GA. bioRxiv 2026.02.09.704077; doi: 10.64898/2026.02.09.704077 10.64898/2026.02.09.704077