LentiCRISPR-B_2xsgRNAs_TRNAU1AP (pAVA3291)
(Plasmid
#254883)
-
PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting TRNAU1AP
-
Depositing Lab
-
Depositing OrganizationClemson University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLentiCRISPR-B
-
Vector typeLentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTwo sgRNAs targeting TRNAU1AP
-
gRNA/shRNA sequencetgctcttgtttttacgcagC/gagatgagacttacCCAGTG
-
SpeciesH. sapiens (human)
- Promoter U6/7SK
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTCTTGGGTAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPR-B_2xsgRNAs_TRNAU1AP (pAVA3291) was a gift from Andrei Alexandrov (Addgene plasmid # 254883 ; http://n2t.net/addgene:254883 ; RRID:Addgene_254883) -
For your References section:
TRNAU1AP and PRPF39 establish integrated control over processing of most abundant human non-coding RNAs. Panah M, Che R, Mirani B, Chen X, Luo H, Alexandrov A. Nat Commun. 2026 Jun 11. doi: 10.1038/s41467-026-74036-6. 10.1038/s41467-026-74036-6 PubMed 42277007