Skip to main content

LentiCRISPR-B_sgRNA_WDR61 (pAVA3321)
(Plasmid #254886)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254886 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    LentiCRISPR-B
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sinlge sgRNA targeting WDR61
  • gRNA/shRNA sequence
    CCTGTTGAAGGCGTGATGAG
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPR-B_sgRNA_WDR61 (pAVA3321) was a gift from Andrei Alexandrov (Addgene plasmid # 254886 ; http://n2t.net/addgene:254886 ; RRID:Addgene_254886)
  • For your References section:

    TRNAU1AP and PRPF39 establish integrated control over processing of most abundant human non-coding RNAs. Panah M, Che R, Mirani B, Chen X, Luo H, Alexandrov A. Nat Commun. 2026 Jun 11. doi: 10.1038/s41467-026-74036-6. 10.1038/s41467-026-74036-6 PubMed 42277007