PLCG2-M28L
(Plasmid
#254917)
-
PurposeExpress PLCG2-M28L (disease variant) in human induced pluripotent stem cells.
-
Depositing Lab
-
Depositing OrganizationIndiana University, Indianapolis
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254917 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC57
-
Backbone manufacturerGenscript
- Backbone size w/o insert (bp) 4080
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namephospholipase C gamma 2 - M28L
-
Alt namePLCG2 - M28L
-
gRNA/shRNA sequenceATCAAGAGAGCCCTGGAGCT
-
SpeciesH. sapiens (human)
-
Entrez GenePLCG2 (a.k.a. APLAID, FCAS3, PLC-IV, PLC-gamma-2)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PLCG2-M28L was a gift from Jason Meyer (Addgene plasmid # 254917 ; http://n2t.net/addgene:254917 ; RRID:Addgene_254917) -
For your References section:
Alzheimer's disease-associated PLCG2 variants alter microglial state and function in human induced pluripotent stem cell-derived microglia-like cells. Bedford LM, Tutrow KD, Hooper K, Messenger EJ, Hernandez M, Lamb BT, Meyer JS, Richardson TI, Bissel SJ. Alzheimers Dement. 2025 Oct;21(10):e70772. doi: 10.1002/alz.70772. 10.1002/alz.70772 PubMed 41066163