pIC-RFP-1
(Plasmid
#254928)
-
PurposeAll-in-one plasmid developed for inducible CRISPRi-assisted genome editing in Streptomyces
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonep15A
-
Vector typeCRISPR, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedCas9
-
Insert Size (bp)4107
- Promoter SP30
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tctaagtaaggagtgtccat
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIC-RFP-1 was a gift from Gilles van Wezel (Addgene plasmid # 254928 ; http://n2t.net/addgene:254928 ; RRID:Addgene_254928) -
For your References section:
Inducible CRISPRi enables efficient and high-fidelity genome editing in Streptomyces. Bai C, Zhu H, Bayona LM, Du C, van Wezel GP. Nucleic Acids Res. 2026 Jun 8;54(11):gkag560. doi: 10.1093/nar/gkag560. 10.1093/nar/gkag560 PubMed 42258544