Donor idCas9-VP64-Blast
(Plasmid
#255021)
-
PurposeDonor plasmid targeting the AAVS1 human locus to express dCas9-VP64 upon dox induction
-
Depositing Lab
-
Depositing OrganizationMemorial Sloan-Kettering Cancer Center
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255021 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonehuman AAVS1 donor
-
Backbone manufacturerHuangfu Lab
- Backbone size w/o insert (bp) 5729
- Total vector size (bp) 10223
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-VP64
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4494
- Promoter Tight TRE
-
Tag
/ Fusion Protein
- 3x FLAG (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TTAGTGAACCGTCAGATCGCCT
- 3′ sequencing primer ccttatattcccagggccggt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The dCas9-VP64 donor was generated by cloning the VP64 fragment from the Addgene plasmid 61425 by In-fusion reaction (Takara) replacing the KRAB cassette from the Donor idCas9-KRAB-Blast plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Donor idCas9-VP64-Blast was a gift from Danwei Huangfu (Addgene plasmid # 255021 ; http://n2t.net/addgene:255021 ; RRID:Addgene_255021) -
For your References section:
Functional chromatin signatures premark future lineage-specific enhancers. Pulecio J, Tayyebi Z, Liu D, Wong W, Luo R, Damodaran JR, Kaplan SJ, Hu N, Cho HS, Yan J, Murphy D, Rickert RW, Shukla A, Zhong A, Torre D, Li Q, Gonzalez F, Yang D, Li W, Zhou T, Apostolou E, Leslie CS, Huangfu D. Cell Genom. 2026 Mar 18:101189. doi: 10.1016/j.xgen.2026.101189. 10.1016/j.xgen.2026.101189 PubMed 41856116