Skip to main content
Addgene
Open Menu

Donor idCas9-VP64-Blast
(Plasmid #255021)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 255021 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    human AAVS1 donor
  • Backbone manufacturer
    Huangfu Lab
  • Backbone size w/o insert (bp) 5729
  • Total vector size (bp) 10223
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-VP64
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4494
  • Promoter Tight TRE
  • Tag / Fusion Protein
    • 3x FLAG (N terminal on insert)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer TTAGTGAACCGTCAGATCGCCT
  • 3′ sequencing primer ccttatattcccagggccggt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The dCas9-VP64 donor was generated by cloning the VP64 fragment from the Addgene plasmid 61425 by In-fusion reaction (Takara) replacing the KRAB cassette from the Donor idCas9-KRAB-Blast plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Donor idCas9-VP64-Blast was a gift from Danwei Huangfu (Addgene plasmid # 255021 ; http://n2t.net/addgene:255021 ; RRID:Addgene_255021)

  • For your References section:

    Functional chromatin signatures premark future lineage-specific enhancers. Pulecio J, Tayyebi Z, Liu D, Wong W, Luo R, Damodaran JR, Kaplan SJ, Hu N, Cho HS, Yan J, Murphy D, Rickert RW, Shukla A, Zhong A, Torre D, Li Q, Gonzalez F, Yang D, Li W, Zhou T, Apostolou E, Leslie CS, Huangfu D. Cell Genom. 2026 Mar 18:101189. doi: 10.1016/j.xgen.2026.101189. 10.1016/j.xgen.2026.101189 PubMed 41856116
Related items: