Donor idCas9-KRAB-Blast
(Plasmid #255020)

• Purpose: Donor plasmid targeting the AAVS1 human locus to express dCas9-KRAB upon dox induction
• Depositing Lab: Danwei Huangfu
• Publication: Pulecio et al Cell Genom. 2026 Mar 18:101189. doi: 10.1016/j.xgen.2026.101189.

Backbone

• Vector backbone: human AAVS1 donor
• Backbone manufacturer: Huangfu Lab
• Backbone size w/o insert (bp): 5874
• Total vector size (bp): 10464
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9-KRAB
• Species: Streptococcus pyogenes
• Insert Size (bp): 4590
• Promoter: Tight TRE
• Tag / Fusion Protein:
  • 3x FLAG (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTAGTGAACCGTCAGATCGCCT
• 3′ sequencing primer: ccttatattcccagggccggt

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The dCas9-KRAB donor was generated through two rounds of QuikChange II Site-Directed Mutagenesis Kit (Agilent), using the Puro-Cas9 donor (Addgene plasmid 58409) as template. The final donor plasmid was generated through Gibson cloning (NEB) of a synthetic FseI-HA-KRAB-AscI DNA fragment (GenScript) flanked by 50 nucleotide homology arms into Puro-dCas9 donor cut FseI-AscI and the plasmid backbone was further replaced with one containing a low copy number origin of replication. PCR-amplified donor sequences were independently cloned by In-fusion reaction (Takara) into the backbone of the Addgene plasmid 58409 which contains the homology arms (HA) to target the AAVS1 locus. Blasticidin selection cassette from the Addgene plasmid 61425 was cloned by In-fusion reaction (Takara) replacing the Puromycin resistance.