pAAV-hSyn-synaptophysin-HYlight2
(Plasmid
#255339)
-
PurposeExpresses HYlight2 localized to synapses in neurons
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255339 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4812
- Total vector size (bp) 7278
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSynaptophysin-HYlight2
-
SpeciesH. sapiens (human); E. coli
-
Insert Size (bp)2463
- Promoter Synapsin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCACGCGAGGCGCGAGATAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.04.29.721630 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-synaptophysin-HYlight2 was a gift from Alison Tebo (Addgene plasmid # 255339 ; http://n2t.net/addgene:255339 ; RRID:Addgene_255339) -
For your References section:
Improved sensors for fructose-1,6-bisphosphate enable in vivo imaging of glycolysis. Tyler J, Vishwanath AA, Menon T, Duarah T, Adhikari R, Koberstein JN, Feliciano D, Espinosa-Medina I, Colón-Ramos D, Tebo AG. bioRxiv 2026.04.29.721630 10.64898/2026.04.29.721630