pLV hU6-sgNT2-2-hUbC-dCas9-KRAB-T2a-Puro
(Plasmid
#255340)
-
PurposeCRISPRi nontargeting control
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255340 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro
-
Backbone manufacturerCharles Gersbach (Addgene #71236)
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgNT2
-
gRNA/shRNA sequencegctgcatggggcgcgaatca
-
SpeciesSynthetic
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV hU6-sgNT2-2-hUbC-dCas9-KRAB-T2a-Puro was a gift from Kenneth Chen (Addgene plasmid # 255340 ; http://n2t.net/addgene:255340 ; RRID:Addgene_255340) -
For your References section:
DROSHA Regulates Mesenchymal Gene Expression in Wilms Tumor. Tiburcio PDB, Desai K, Kim J, Zhou Q, Guo L, Xiao X, Zhou L, Yuksel A, Catchpoole DR, Amatruda JF, Xu L, Chen KS. Mol Cancer Res. 2024 Aug 2;22(8):711-720. doi: 10.1158/1541-7786.MCR-23-0930. 10.1158/1541-7786.MCR-23-0930 PubMed 38647377