pLV EF1a Fluc2 2A GFP 2A BSD
(Plasmid
#255456)
-
PurposeExpresses firefly luciferase, eGFP, and blasticidin deaminase from a lentiviral vector
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255456 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLenticrispr V2
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase 2, eGFP, Blasticidin deainase
- Promoter Ef1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccccacactgagtgggtggag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV EF1a Fluc2 2A GFP 2A BSD was a gift from Le Cong (Addgene plasmid # 255456 ; http://n2t.net/addgene:255456 ; RRID:Addgene_255456)