pLV EFS PCP-p65-HSF1 2A mcherry2 2A HygR
(Plasmid
#255462)
-
PurposeExpresses SAM components PCP-p65-HSF1, mcherry2, and hygromycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLenticrispr V2
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep65-HSF1
-
SpeciesH. sapiens (human)
- Promoter EFS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgtacggccaccatgtcgcggag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV EFS PCP-p65-HSF1 2A mcherry2 2A HygR was a gift from Le Cong (Addgene plasmid # 255462 ; http://n2t.net/addgene:255462 ; RRID:Addgene_255462)