pFLAG-CMV2-MLL4fusion
(Plasmid
#255997)
-
PurposeThis plasmid expresses a mini-version of human MLL4 (aka KMT2D), which is composed of a tandem PHD (PHD4-6;1358–1572aa) and a SET (catalytic domain)-containing C-terminal region (4507–5537aa).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 255997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFLAG-CMV-2
-
Backbone manufacturerSigma
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMLL4 fusion
-
Alt nameKMT2D
-
SpeciesH. sapiens (human)
-
MutationMLL4fusion with PHD(4-6) 1358–1572 and SET (catalytic domain) 4507–5537
-
Entrez GeneKMT2D (a.k.a. AAD10, ALR, BCAHH, CAGL114, KABUK1, KMS, MLL2, MLL4, TNRC21)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFrom Dr. Lee lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFLAG-CMV2-MLL4fusion was a gift from Min Gyu Lee (Addgene plasmid # 255997 ; http://n2t.net/addgene:255997 ; RRID:Addgene_255997) -
For your References section:
Trans-tail regulation of MLL4-catalyzed H3K4 methylation by H4R3 symmetric dimethylation is mediated by a tandem PHD of MLL4. Dhar SS, Lee SH, Kan PY, Voigt P, Ma L, Shi X, Reinberg D, Lee MG. Genes Dev. 2012 Dec 15;26(24):2749-62. doi: 10.1101/gad.203356.112. 10.1101/gad.203356.112 PubMed 23249737