Skip to main content

pT2K-CAGGSv3-murine IL-33-P2A-mCherry
(Plasmid #256113)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 256113 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pT2K-CAGGSv3-EGFP
  • Backbone manufacturer
    K. Kawakami
  • Backbone size w/o insert (bp) 8960
  • Total vector size (bp) 8126
  • Vector type
    Mammalian Expression ; transposon-based vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IL-33
  • Alt name
    Interleukin-33
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    867
  • Mutation
    A P2A sequence is fused to the C-terminus of mIL-33, allowing ribosomal skipping and co-expression of mCherry as a separate protein.
  • GenBank ID
    NM_001360725.1
  • Entrez Gene
    Il33 (a.k.a. 9230117N10Rik, Il-33, Il1f11, NF-HEV)
  • Promoter CAG
  • Tag / Fusion Protein
    • P2A-mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer cgccggcaggaaggaaat
  • 3′ sequencing primer CCCTTGGTCACCTTCAGCTT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT2K-CAGGSv3-murine IL-33-P2A-mCherry was a gift from Hiroyasu Nakano (Addgene plasmid # 256113 ; http://n2t.net/addgene:256113 ; RRID:Addgene_256113)
  • For your References section:

    Temporal control of Ninj1 activation determines cell-to-cell heterogeneity in IL-33 release. Kanokogi T, Komazawa-Sakon S, Murai S, Moriwaki K, Shirasaki Y, Yamagishi M, Sumiyama K, Kishi K, Nakano H. Commun Biol. 2026 May 21. doi: 10.1038/s42003-026-10300-1. 10.1038/s42003-026-10300-1 PubMed 42168568