pBK lpp MaPylT metG ASV
(Plasmid
#256311)
-
PurposePlasmid encoding mutant M alvus pyrrolysyl synthetase-ASV and tRNA for o-cyanophenylalanine
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 256311 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneColE1
- Total vector size (bp) 3034
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameM. alvus pyrrolysyl synthetase
-
Insert Size (bp)828
- Promoter metG
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATATAAAGGATCCCGCCGCTTCTTTGAGCGAACGATC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametRNAMaPyl
-
Insert Size (bp)71
- Promoter lpp
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ATATAAAGGATCCCGCCGCTTCTTTGAGCGAACGATC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBK lpp MaPylT metG ASV was a gift from Abhishek Chatterjee (Addgene plasmid # 256311 ; http://n2t.net/addgene:256311 ; RRID:Addgene_256311) -
For your References section:
A Translation-Independent Directed Evolution Strategy to Engineer Aminoacyl-tRNA Synthetases. Soni C, Prywes N, Hall M, Nair MA, Savage DF, Schepartz A, Chatterjee A. ACS Cent Sci. 2024 May 20;10(6):1211-1220. doi: 10.1021/acscentsci.3c01557. eCollection 2024 Jun 26. 10.1021/acscentsci.3c01557 PubMed 38947215