pBK proK-lacI MaPylT metG FCVF
(Plasmid
#256313)
-
PurposePlasmid encoding mutant M. alvus pyrrolysyl synthetase-FCVF and inducible tRNA for β2-hydroxy acid monomers
-
Depositing Lab
-
Depositing OrganizationBoston College
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 256313 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneColE1
- Total vector size (bp) 4596
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsSupplement with 1% glucose to suppress basal tRNA expression and mitigate toxicity
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameM. alvus pyrrolysyl synthetase-FCVF
-
Insert Size (bp)828
-
MutationM120F, M164C, Y206F
- Promoter metG
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CGACCGAATTTCTGCCATTCATCCG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametRNA-MaPyl
-
Insert Size (bp)71
- Promoter proK-lacI
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTGTTAGCCTGCAGGTAATTCCGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBK proK-lacI MaPylT metG FCVF was a gift from Abhishek Chatterjee (Addgene plasmid # 256313 ; http://n2t.net/addgene:256313 ; RRID:Addgene_256313) -
For your References section:
Co-Translational Incorporation of (R)- and (S)-beta(2)-Hydroxyacids In Vivo: Directed Evolution of Efficient Aminoacyl-tRNA Synthetases. Soni C, Pressimone M, Nair M, Szalay K, Hall M, Hamlish N, Solivan AC, Schepartz A, Chatterjee A. J Am Chem Soc. 2026 Mar 11;148(9):9382-9392. doi: 10.1021/jacs.5c18595. Epub 2026 Feb 27. 10.1021/jacs.5c18595 PubMed 41757713