pEvol T5-lac Nluc WT
(Plasmid
#256315)
-
PurposePlasmid encoding reporter gene Nanoluciferase wild-type
-
Depositing Lab
-
Depositing OrganizationBoston College
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 256315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonep15A ori
- Total vector size (bp) 4315
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNluc WT
-
Insert Size (bp)534
- Promoter T5-lac
-
Tag
/ Fusion Protein
- 6xHis tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gatctcgacgctctcccttatgcgac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEvol T5-lac Nluc WT was a gift from Abhishek Chatterjee (Addgene plasmid # 256315 ; http://n2t.net/addgene:256315 ; RRID:Addgene_256315) -
For your References section:
Co-Translational Incorporation of (R)- and (S)-beta(2)-Hydroxyacids In Vivo: Directed Evolution of Efficient Aminoacyl-tRNA Synthetases. Soni C, Pressimone M, Nair M, Szalay K, Hall M, Hamlish N, Solivan AC, Schepartz A, Chatterjee A. J Am Chem Soc. 2026 Mar 11;148(9):9382-9392. doi: 10.1021/jacs.5c18595. Epub 2026 Feb 27. 10.1021/jacs.5c18595 PubMed 41757713