Skip to main content

pB1-MaPylRS-MMIF-4xG55T-TAG
(Plasmid #256353)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 256353 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pB1
  • Total vector size (bp) 10249
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    MaPylRS-MMIF
  • Species
    Methanomethylophilus alvi
  • Insert Size (bp)
    828
  • Mutation
    V205I, Y206F
  • Promoter CMV

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    MaPylT*
  • Mutation
    G55T
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GGCTATGAACTAATGACCCCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pB1-MaPylRS-MMIF-4xG55T-TAG was a gift from Abhishek Chatterjee (Addgene plasmid # 256353 ; http://n2t.net/addgene:256353 ; RRID:Addgene_256353)
  • For your References section:

    Co-Translational Incorporation of (R)- and (S)-beta(2)-Hydroxyacids In Vivo: Directed Evolution of Efficient Aminoacyl-tRNA Synthetases. Soni C, Pressimone M, Nair M, Szalay K, Hall M, Hamlish N, Solivan AC, Schepartz A, Chatterjee A. J Am Chem Soc. 2026 Mar 11;148(9):9382-9392. doi: 10.1021/jacs.5c18595. Epub 2026 Feb 27. 10.1021/jacs.5c18595 PubMed 41757713