pB1-EGFP-39-TAG-12xHis
(Plasmid
#256355)
-
PurposePlasmid encoding EGFP-39-TAG reporter with His tag for HEK cell expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 256355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepB1
- Backbone size w/o insert (bp) 7982
- Total vector size (bp) 8795
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP-39-TAG
-
SpeciesAequorea victoria
-
Insert Size (bp)813
-
MutationReplaced Tyrosine 39 with TAG stop codon
- Promoter CMV
-
Tag
/ Fusion Protein
- C-terminal 12xHis tag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caagtgtatcatatgccaagtacgccccctattg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB1-EGFP-39-TAG-12xHis was a gift from Abhishek Chatterjee (Addgene plasmid # 256355 ; http://n2t.net/addgene:256355 ; RRID:Addgene_256355) -
For your References section:
Co-Translational Incorporation of (R)- and (S)-beta(2)-Hydroxyacids In Vivo: Directed Evolution of Efficient Aminoacyl-tRNA Synthetases. Soni C, Pressimone M, Nair M, Szalay K, Hall M, Hamlish N, Solivan AC, Schepartz A, Chatterjee A. J Am Chem Soc. 2026 Mar 11;148(9):9382-9392. doi: 10.1021/jacs.5c18595. Epub 2026 Feb 27. 10.1021/jacs.5c18595 PubMed 41757713