pcDNA CAG ChrimsonR dTom
(Plasmid
#256461)
-
Purposeexcitatory channelrhodopsin
-
Depositing Lab
-
Depositing OrganizationCentral Michigan University
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 256461 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 6274
- Total vector size (bp) 8068
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChrimsonR dTom
-
SpeciesSynthetic
-
Insert Size (bp)1794
- Promoter CAG
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer caccatggctgagctgatcag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA CAG ChrimsonR dTom was a gift from Ute Hochgeschwender (Addgene plasmid # 256461 ; http://n2t.net/addgene:256461 ; RRID:Addgene_256461)