Skip to main content

pKT07_AAV-hU6-AsDR-crTSG1-EFS-Cre-T2A-hNGFR
(Plasmid #256630)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 256630 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pAAV
  • Vector type
    AAV
  • Selectable markers
    truncated hNGFR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    crTrp53, crPten, crApc, crRb1
  • gRNA/shRNA sequence
    CCAGGCCGGCTCTGAGTATACCA, CCCCGATGCAATAAATATGCACA, ACGCCAATCGACATGATGATAGT, ACTTACTGCTATACGTAGCCATT
  • Species
    M. musculus (mouse)
  • Promoter humanU6, EFS-NS

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKT07_AAV-hU6-AsDR-crTSG1-EFS-Cre-T2A-hNGFR was a gift from Sidi Chen (Addgene plasmid # 256630 ; http://n2t.net/addgene:256630 ; RRID:Addgene_256630)
  • For your References section:

    Cas12a-knock-in mice for multiplexed genome editing, disease modelling and immune-cell engineering. Tang K, Zhou L, Tian X, Fang SY, Vandenbulcke E, Du A, Shen J, Cao H, Zhou J, Chen K, Kim HR, Luo Z, Xin S, Lin SH, Park D, Yang L, Zhang Y, Suzuki K, Majety M, Ling X, Lam SZ, Chow RD, Ren P, Tao B, Li K, Codina A, Dai X, Shang X, Bai S, Nottoli T, Levchenko A, Booth CJ, Liu C, Fan R, Dong MB, Zhou X, Chen S. Nat Biomed Eng. 2025 Aug;9(8):1290-1308. doi: 10.1038/s41551-025-01371-2. Epub 2025 Mar 20. 10.1038/s41551-025-01371-2 PubMed 40114032