pKT07_AAV-hU6-AsDR-crTSG1-EFS-Cre-T2A-hNGFR
(Plasmid
#256630)
-
PurposeAAV vector for delivery of AsCas12a crTSG1 guide array and expressing Cre using EFS promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 256630 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV
-
Vector typeAAV
-
Selectable markerstruncated hNGFR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecrTrp53, crPten, crApc, crRb1
-
gRNA/shRNA sequenceCCAGGCCGGCTCTGAGTATACCA, CCCCGATGCAATAAATATGCACA, ACGCCAATCGACATGATGATAGT, ACTTACTGCTATACGTAGCCATT
-
SpeciesM. musculus (mouse)
- Promoter humanU6, EFS-NS
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKT07_AAV-hU6-AsDR-crTSG1-EFS-Cre-T2A-hNGFR was a gift from Sidi Chen (Addgene plasmid # 256630 ; http://n2t.net/addgene:256630 ; RRID:Addgene_256630) -
For your References section:
Cas12a-knock-in mice for multiplexed genome editing, disease modelling and immune-cell engineering. Tang K, Zhou L, Tian X, Fang SY, Vandenbulcke E, Du A, Shen J, Cao H, Zhou J, Chen K, Kim HR, Luo Z, Xin S, Lin SH, Park D, Yang L, Zhang Y, Suzuki K, Majety M, Ling X, Lam SZ, Chow RD, Ren P, Tao B, Li K, Codina A, Dai X, Shang X, Bai S, Nottoli T, Levchenko A, Booth CJ, Liu C, Fan R, Dong MB, Zhou X, Chen S. Nat Biomed Eng. 2025 Aug;9(8):1290-1308. doi: 10.1038/s41551-025-01371-2. Epub 2025 Mar 20. 10.1038/s41551-025-01371-2 PubMed 40114032