pCAG-eSpCas9-2A-GFP-sgRNA-PAXX
(Plasmid
#257236)
-
PurposeTo generate PAXX KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against PAXX exon 2.
-
Depositing Lab
-
Depositing OrganizationCNRS, Delegation Occitanie Ouest
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257236 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAG-eSpCas9-2A-GFP
-
Backbone manufacturerAddgene #79145
- Backbone size w/o insert (bp) 10225
- Total vector size (bp) 10246
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting PAXX exon 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)21
-
Entrez GenePAXX (a.k.a. C9orf142, XLS)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer SEQ-U6-F (ATGGACTATCATATGCTTACCG)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid generated by Philippe Frit.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-eSpCas9-2A-GFP-sgRNA-PAXX was a gift from Sébastien Britton (Addgene plasmid # 257236 ; http://n2t.net/addgene:257236 ; RRID:Addgene_257236) -
For your References section:
PAXX binding to the NHEJ machinery explains functional redundancy with XLF. Seif-El-Dahan M, Kefala-Stavridi A, Frit P, Hardwick SW, Chirgadze DY, Maia De Oliviera T, Andreani J, Britton S, Barboule N, Bossaert M, Pandurangan AP, Meek K, Blundell TL, Ropars V, Calsou P, Charbonnier JB, Chaplin AK. Sci Adv. 2023 Jun 2;9(22):eadg2834. doi: 10.1126/sciadv.adg2834. Epub 2023 May 31. 10.1126/sciadv.adg2834 PubMed 37256950