Skip to main content
Addgene
Open Menu

pCAG-eSpCas9-2A-GFP-sgRNA-XLF
(Plasmid #257237)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 257237 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pCAG-eSpCas9-2A-GFP
  • Backbone manufacturer
    Addgene #79145
  • Backbone size w/o insert (bp) 10225
  • Total vector size (bp) 10245
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting XLF exon 3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    NHEJ1 (a.k.a. IMD124, MCOPCB13, XLF)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer SEQ-U6-F (ATGGACTATCATATGCTTACCG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid generated by Philippe Frit.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-eSpCas9-2A-GFP-sgRNA-XLF was a gift from Sébastien Britton (Addgene plasmid # 257237 ; http://n2t.net/addgene:257237 ; RRID:Addgene_257237)

  • For your References section:

    PAXX binding to the NHEJ machinery explains functional redundancy with XLF. Seif-El-Dahan M, Kefala-Stavridi A, Frit P, Hardwick SW, Chirgadze DY, Maia De Oliviera T, Andreani J, Britton S, Barboule N, Bossaert M, Pandurangan AP, Meek K, Blundell TL, Ropars V, Calsou P, Charbonnier JB, Chaplin AK. Sci Adv. 2023 Jun 2;9(22):eadg2834. doi: 10.1126/sciadv.adg2834. Epub 2023 May 31. 10.1126/sciadv.adg2834 PubMed 37256950
Related items: