pLKO-shABCB7.1-puro
(Plasmid
#257591)
-
PurposeExpresses shRNA targeting ABCB7
-
Depositing Lab
-
Depositing OrganizationRockefeller University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257591 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLKO.1 (TRC shRNA backbone)
-
Backbone manufacturerSigma/Broad Institute TRC
- Backbone size w/o insert (bp) 7050
-
Vector typeLentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameABCB7
-
gRNA/shRNA sequenceCCGGGCACAGAGATATGATGGATTTCTCGAGAAATCCATCATATCTCTGTGCTTTTTG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneABCB7 (a.k.a. ABC7, ASAT, Atm1p, EST140535)
- Promoter U6 (shRNA); PGK (puroR)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shRNA construct
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-shABCB7.1-puro was a gift from Kivanc Birsoy (Addgene plasmid # 257591 ; http://n2t.net/addgene:257591 ; RRID:Addgene_257591) -
For your References section:
Autoregulatory control of mitochondrial glutathione homeostasis. Liu Y, Liu S, Tomar A, Yen FS, Unlu G, Ropek N, Weber RA, Wang Y, Khan A, Gad M, Peng J, Terzi E, Alwaseem H, Pagano AE, Heissel S, Molina H, Allwein B, Kenny TC, Possemato RL, Zhao L, Hite RK, Vinogradova EV, Mansy SS, Birsoy K. Science. 2023 Nov 17;382(6672):820-828. doi: 10.1126/science.adf4154. Epub 2023 Nov 2. 10.1126/science.adf4154 PubMed 37917749