Skip to main content

pLKO-shABCB7.1-puro
(Plasmid #257591)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 257591 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLKO.1 (TRC shRNA backbone)
  • Backbone manufacturer
    Sigma/Broad Institute TRC
  • Backbone size w/o insert (bp) 7050
  • Vector type
    Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ABCB7
  • gRNA/shRNA sequence
    CCGGGCACAGAGATATGATGGATTTCTCGAGAAATCCATCATATCTCTGTGCTTTTTG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    ABCB7 (a.k.a. ABC7, ASAT, Atm1p, EST140535)
  • Promoter U6 (shRNA); PGK (puroR)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

shRNA construct

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-shABCB7.1-puro was a gift from Kivanc Birsoy (Addgene plasmid # 257591 ; http://n2t.net/addgene:257591 ; RRID:Addgene_257591)
  • For your References section:

    Autoregulatory control of mitochondrial glutathione homeostasis. Liu Y, Liu S, Tomar A, Yen FS, Unlu G, Ropek N, Weber RA, Wang Y, Khan A, Gad M, Peng J, Terzi E, Alwaseem H, Pagano AE, Heissel S, Molina H, Allwein B, Kenny TC, Possemato RL, Zhao L, Hite RK, Vinogradova EV, Mansy SS, Birsoy K. Science. 2023 Nov 17;382(6672):820-828. doi: 10.1126/science.adf4154. Epub 2023 Nov 2. 10.1126/science.adf4154 PubMed 37917749