lentiCRISPR-v2_sg2_SYVN1
(Plasmid
#257611)
-
PurposeCRISPR knockout of SYVN1 using sgRNA 2
-
Depositing Lab
-
Depositing OrganizationRockefeller University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257611 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonelentiCRISPR-v2
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesg2_SYVN1
-
gRNA/shRNA sequenceGATGGCTCGGCGAGACATGA
-
SpeciesH. sapiens (human)
-
Entrez GeneSYVN1 (a.k.a. DER3, HRD1)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site N/A (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR-v2_sg2_SYVN1 was a gift from Kivanc Birsoy (Addgene plasmid # 257611 ; http://n2t.net/addgene:257611 ; RRID:Addgene_257611) -
For your References section:
SLC33A1 exports oxidized glutathione to maintain endoplasmic reticulum redox homeostasis. Liu S, Gad M, Li C, Cho K, Liu Y, Wangdu K, Belay V, Millet A, Kojima H, Sanford H, Wolk M, Urnavicius L, Fedorova M, Patti GJ, Vinogradova EV, Hite RK, Birsoy K. Nat Cell Biol. 2026 Apr 17. doi: 10.1038/s41556-026-01922-y. 10.1038/s41556-026-01922-y PubMed 41998286