pLS-hu6-EGFP-sc-lentiMPRA
(Plasmid
#257694)
-
Purpose(Empty Backbone) Lentivirus single-cell reporter assay plasmid that contains an hu6 promoter and an EGFP reporter gene to insert barcoded gRNAs and barcoded cis-regulatory elements.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257694 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLS-hu6-EGFP-sc-lentiMPRA
- Backbone size (bp) 8066
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcttcttgtgtatatccggtc
- 3′ sequencing primer catcctggtcgagctggac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.02.27.708495 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLS-hu6-EGFP-sc-lentiMPRA was a gift from Lars Velten (Addgene plasmid # 257694 ; http://n2t.net/addgene:257694 ; RRID:Addgene_257694) -
For your References section:
Lentiviral single-cell MPRA of synthetic enhancers reveals motif affinity-based encoding of cell state specificity. Ruhle J, Fromel R, Martinez AB, Szu-Tu C, Bowness J, Velten L. Genome Biol. 2026 Jul 14. doi: 10.1186/s13059-026-04186-9. 10.1186/s13059-026-04186-9 PubMed 42449439
Map uploaded by the depositor.
