Skip to main content

pCas9_soc_crRNA
(Plasmid #257705)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 257705 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pACYC184
  • Backbone size w/o insert (bp) 4244
  • Total vector size (bp) 9316
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SpCas9
  • Alt name
    Cas9 and crRNA targeting the T4 phage soc (tgtgaacgtcagaataaaga)
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4107

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Derived from Addgene plasmid #42876 (Luciano Marraffini) and modified to express crRNA targeting the T4 phage soc gene.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCas9_soc_crRNA was a gift from Juhong Chen (Addgene plasmid # 257705 ; http://n2t.net/addgene:257705 ; RRID:Addgene_257705)
  • For your References section:

    CRISPR/Cas9-Mediated Genome Editing of T4 Bacteriophage for High-Throughput Antimicrobial Susceptibility Testing. He Y, Chen J. Anal Chem. 2024 Nov 12;96(45):18301-18310. doi: 10.1021/acs.analchem.4c05177. Epub 2024 Oct 30. 10.1021/acs.analchem.4c05177 PubMed 39474820