pCas9_soc_crRNA
(Plasmid
#257705)
-
PurposeBacterial expression plasmid encoding Cas9 nuclease, tracrRNA, and crRNA targeting the soc gene of T4 phage
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Riverside
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257705 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepACYC184
- Backbone size w/o insert (bp) 4244
- Total vector size (bp) 9316
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSpCas9
-
Alt nameCas9 and crRNA targeting the T4 phage soc (tgtgaacgtcagaataaaga)
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4107
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDerived from Addgene plasmid #42876 (Luciano Marraffini) and modified to express crRNA targeting the T4 phage soc gene.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas9_soc_crRNA was a gift from Juhong Chen (Addgene plasmid # 257705 ; http://n2t.net/addgene:257705 ; RRID:Addgene_257705) -
For your References section:
CRISPR/Cas9-Mediated Genome Editing of T4 Bacteriophage for High-Throughput Antimicrobial Susceptibility Testing. He Y, Chen J. Anal Chem. 2024 Nov 12;96(45):18301-18310. doi: 10.1021/acs.analchem.4c05177. Epub 2024 Oct 30. 10.1021/acs.analchem.4c05177 PubMed 39474820