pEB29 (C-terminal mANGPTL3 -Strep)
(Plasmid
#257785)
-
PurposeExpresses the C-terminal fibrinogen-like domain of mouse ANGPTL3 in mammalian cells. Contains signal peptide and is Strep tagged.
-
Depositing Lab
-
Depositing OrganizationUniversity of Iowa
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 257785 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA6
- Backbone size w/o insert (bp) 4989
- Total vector size (bp) 6348
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameANGPTL3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)765
-
MutationDeleted amino acids 17-224
-
Entrez GeneAngptl3 (a.k.a. hypl)
-
Tag
/ Fusion Protein
- StrepII (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer AGGAAAGGACAGTGGGAGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEB29 (C-terminal mANGPTL3 -Strep) was a gift from Brandon Davies (Addgene plasmid # 257785 ; http://n2t.net/addgene:257785 ; RRID:Addgene_257785) -
For your References section:
ANGPTL8 promotes the ability of ANGPTL3 to bind and inhibit lipoprotein lipase. Chi X, Britt EC, Shows HW, Hjelmaas AJ, Shetty SK, Cushing EM, Li W, Dou A, Zhang R, Davies BSJ. Mol Metab. 2017 Oct;6(10):1137-1149. doi: 10.1016/j.molmet.2017.06.014. Epub 2017 Jun 29. 10.1016/j.molmet.2017.06.014 PubMed 29031715