Skip to main content

pLentiCRISPR v2 PPP1R18 sg1
(Plasmid #258071)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 258071 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    LentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang, Addgene plasmid #52961
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PPP1R18
  • Alt name
    Phostensin
  • gRNA/shRNA sequence
    CACCGCTGTCCGAGACCCTGACAA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    KIAA1949 (a.k.a. HKMT1098)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmbI (unknown if destroyed)
  • 5′ sequencing primer U6
  • 3′ sequencing primer Cas9-R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPR v2 PPP1R18 sg1 was a gift from Alexis Jourdain (Addgene plasmid # 258071 ; http://n2t.net/addgene:258071 ; RRID:Addgene_258071)
  • For your References section:

    Uridine-sensitized screening identifies demethoxy-coenzyme Q and NUDT5 as regulators of nucleotide synthesis. Strefeler A, Baker ZN, Chollet S, Foged MM, Guerra RM, Ivanisevic J, Gallart-Ayala H, Pagliarini DJ, Jourdain AA. Nat Metab. 2025 Nov;7(11):2221-2235. doi: 10.1038/s42255-025-01419-2. Epub 2025 Nov 13. 10.1038/s42255-025-01419-2 PubMed 41233602