plentiCRISPR v2 PPAT sg2
(Plasmid
#258074)
-
PurposeKnockout
-
Depositing Lab
-
Depositing OrganizationUniversite de Lausanne (UNIL)
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258074 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLentiCRISPR v2
-
Backbone manufacturerFeng Zhang, Addgene plasmid #52961
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePPAT
-
gRNA/shRNA sequenceCACCGAGACCAGACAGTATGTTCGA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GenePPAT (a.k.a. ATASE, GPAT, PRAT)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmbI (unknown if destroyed)
- 5′ sequencing primer U6
- 3′ sequencing primer Cas9-R
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plentiCRISPR v2 PPAT sg2 was a gift from Alexis Jourdain (Addgene plasmid # 258074 ; http://n2t.net/addgene:258074 ; RRID:Addgene_258074) -
For your References section:
Uridine-sensitized screening identifies demethoxy-coenzyme Q and NUDT5 as regulators of nucleotide synthesis. Strefeler A, Baker ZN, Chollet S, Foged MM, Guerra RM, Ivanisevic J, Gallart-Ayala H, Pagliarini DJ, Jourdain AA. Nat Metab. 2025 Nov;7(11):2221-2235. doi: 10.1038/s42255-025-01419-2. Epub 2025 Nov 13. 10.1038/s42255-025-01419-2 PubMed 41233602