pLVX-TetOne-Puro-GFP-3xFLAG
(Plasmid
#258081)
-
PurposeOverexpression
-
Depositing Lab
-
Depositing OrganizationUniversite de Lausanne (UNIL)
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258081 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLVX-TetOne-Puro
-
Backbone manufacturerClontech
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
SpeciesAequorea victoria
-
Insert Size (bp)792
- Promoter TRE3GS
-
Tag
/ Fusion Protein
- 3xFLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site AgeI (unknown if destroyed)
- 5′ sequencing primer AACGGACGTGAAGAATGTG
- 3′ sequencing primer TCACTCTCTTACCCGTCATT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-TetOne-Puro-GFP-3xFLAG was a gift from Alexis Jourdain (Addgene plasmid # 258081 ; http://n2t.net/addgene:258081 ; RRID:Addgene_258081) -
For your References section:
Functional nutrient-genetic profiling reveals biotin and FBXW7 are essential to bypass glutamine addiction. Lisci M, Vericel F, Liu Y, Gallart-Ayala H, Ivanisevic J, Skinner OS, Jourdain AA. Mol Cell. 2026 Mar 5;86(5):901-916.e10. doi: 10.1016/j.molcel.2026.02.002. Epub 2026 Feb 25. 10.1016/j.molcel.2026.02.002 PubMed 41747732