pLentiCRISPR v2 MNT sg1
(Plasmid
#258102)
-
PurposeKnockout
-
Depositing Lab
-
Depositing OrganizationUniversite de Lausanne (UNIL)
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258102 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLentiCRISPR v2
-
Backbone manufacturerFeng Zhang, Addgene plasmid #52961
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMNT
-
Alt nameROX
-
Alt nameBHLHD3
-
gRNA/shRNA sequenceCACCGAAGCGGAACATCCCCAACG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneMNT (a.k.a. ROX, MAD6, MXD6, bHLHd3)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmbI (unknown if destroyed)
- 5′ sequencing primer U6
- 3′ sequencing primer Cas9-R
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPR v2 MNT sg1 was a gift from Alexis Jourdain (Addgene plasmid # 258102 ; http://n2t.net/addgene:258102 ; RRID:Addgene_258102) -
For your References section:
Functional nutrient-genetic profiling reveals biotin and FBXW7 are essential to bypass glutamine addiction. Lisci M, Vericel F, Liu Y, Gallart-Ayala H, Ivanisevic J, Skinner OS, Jourdain AA. Mol Cell. 2026 Mar 5;86(5):901-916.e10. doi: 10.1016/j.molcel.2026.02.002. Epub 2026 Feb 25. 10.1016/j.molcel.2026.02.002 PubMed 41747732