HA-L-SA-2A-PuroR-GFP-TRE-HA-R
(Plasmid
#258166)
-
PurposeDNA template for insertion of doxycycline inducible GFP cassette into the human AAVS1 site
-
Depositing Lab
-
Depositing OrganizationMemorial Sloan-Kettering Cancer Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258166 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePuro-iDEST
-
Backbone manufacturerDanwei Huangfu, Addgene plasmid #75336
- Backbone size w/o insert (bp) 7051
- Total vector size (bp) 6758
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGfp
-
SpeciesAequorea victoria
-
Insert Size (bp)784
-
GenBank IDU57608.1
- Promoter TRE
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGATTGGGAAGACAATAGCAGG
- 3′ sequencing primer CGTCAGATCGCCTGGAGAAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HA-L-SA-2A-PuroR-GFP-TRE-HA-R was a gift from Danwei Huangfu (Addgene plasmid # 258166 ; http://n2t.net/addgene:258166 ; RRID:Addgene_258166) -
For your References section:
Human pancreatic progenitor organoids define genetic and epigenetic barriers to early PDAC transformation. Zhang X, Wong W, Cho HS, Yang D, Dixon G, Luo R, Liu D, Torre D, Umeda S, Gonzalez F, Askan G, Yavas A, Damodaran JR, Rickert RW, Kappagantula R, Pan FC, Aveson VG, Grimont A, Fall WB, Wang X, Pulecio J, Kaplan SJ, Pan H, Peng XL, Yeh JJ, Leach SD, Iacobuzio-Donahue CA, Chandwani R, Leslie CS, Huangfu D. Dev Cell. 2026 May 19:S1534-5807(26)00159-0. doi: 10.1016/j.devcel.2026.04.012. 10.1016/j.devcel.2026.04.012 PubMed 42161274