Skip to main content
Addgene
Open Menu

HA-L-SA-2A-NeoR-CAG-M2rtTA-Cas9-TRE-HA-R
(Plasmid #258168)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 258168 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pAAVS1-NDi-MCS
  • Backbone manufacturer
    Gift from the Bruce Conklin lab
  • Backbone size w/o insert (bp) 8555
  • Total vector size (bp) 12816
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9
  • Alt name
    SpCas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4294
  • GenBank ID
    69900935
  • Promoter TRE
  • Tag / Fusion Protein
    • Flag tagged

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Pac1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer GCTCGTTTAGTGAACCGTC
  • 3′ sequencing primer CCTGTTTACCCTGACCAATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HA-L-SA-2A-NeoR-CAG-M2rtTA-Cas9-TRE-HA-R was a gift from Danwei Huangfu (Addgene plasmid # 258168 ; http://n2t.net/addgene:258168 ; RRID:Addgene_258168)

  • For your References section:

    Human pancreatic progenitor organoids define genetic and epigenetic barriers to early PDAC transformation. Zhang X, Wong W, Cho HS, Yang D, Dixon G, Luo R, Liu D, Torre D, Umeda S, Gonzalez F, Askan G, Yavas A, Damodaran JR, Rickert RW, Kappagantula R, Pan FC, Aveson VG, Grimont A, Fall WB, Wang X, Pulecio J, Kaplan SJ, Pan H, Peng XL, Yeh JJ, Leach SD, Iacobuzio-Donahue CA, Chandwani R, Leslie CS, Huangfu D. Dev Cell. 2026 May 19:S1534-5807(26)00159-0. doi: 10.1016/j.devcel.2026.04.012. 10.1016/j.devcel.2026.04.012 PubMed 42161274
Related items: