Skip to main content

pLIX403_HA-SNRPB_RtoAx2
(Plasmid #258257)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 258257 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCW57.1
  • Backbone manufacturer
    Broad Institute
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SNRPB
  • Alt name
    SmB/B'
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    729
  • Mutation
    R107 and R111 arginine-to-alanine
  • Entrez Gene
    SNRPB (a.k.a. CCMS, COD, SNRPB1, Sm-B/B', SmB/B', SmB/SmB', snRNP-B)
  • Promoter TRE promoter, Tet ON
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLIX403_HA-SNRPB_RtoAx2 was a gift from David Shechter (Addgene plasmid # 258257 ; http://n2t.net/addgene:258257 ; RRID:Addgene_258257)
  • For your References section:

    Productive mRNA chromatin escape is promoted by PRMT5 activity. DeAngelo JD, Maron MI, Roth JS, Hegde S, Silverstein AM, Gupta V, Stransky S, Basken J, Azofeifa J, Query CC, Sidoli S, Gamble MJ, Shechter D. Mol Cell. 2025 Nov 6;85(21):4016-4031.e9. doi: 10.1016/j.molcel.2025.09.021. Epub 2025 Oct 13. 10.1016/j.molcel.2025.09.021 PubMed 41086806