p300_N1196D_R1234E_GFP
(Plasmid
#258517)
-
PurposeExpression of EGFP fused to core p300 histone acetyltransferase with N1196D + R1234E
-
Depositing Lab
-
Depositing OrganizationUniversity of Groningen
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258517 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepIRESpuro2
- Total vector size (bp) -2
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFRB-EGFP-p300 core
-
Alt namep300
-
Alt nameKAT3B
-
Alt nameMKHK2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2907
-
GenBank IDNM_001429
-
Entrez GeneEP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
- Promoter EF1alpha
-
Tags
/ Fusion Proteins
- EGFP (N-terminal of p300 core) (N terminal on insert)
- FRB (N-terminal of EGFP) (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAAGTGCAGTAGTCGCCGTGAACGT
- 3′ sequencing primer CATGCCCGCTTTTGAGA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMutations were introduced in plasmid eGFP-p300 Addgene plasmids #191764 from Daniel Gerlich.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutations were introduced in plasmid eGFP-p300 Addgene plasmids #191764 from Daniel Gerlich.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p300_N1196D_R1234E_GFP was a gift from Geert van den Bogaart (Addgene plasmid # 258517 ; http://n2t.net/addgene:258517 ; RRID:Addgene_258517) -
For your References section:
Butyrate causes loss of specific acetylation by the histone acetyltransferase p300. Jiang M, Psoma A, Lyu J, Chiariello MG, Modderman R, Bianchi F, Incarnato D, Marrink SJ, Jonkers IH, van den Bogaart G. iScience. 2026 Jul 8;29(7):116528. doi: 10.1016/j.isci.2026.116528. eCollection 2026 Jul 17. 10.1016/j.isci.2026.116528 PubMed 42491727