phage UbiC ALFA-Nanobody-sfGFP-GB1
(Plasmid
#258550)
-
PurposeALFA-Nanobody-sfGFP-GB1 for lentivirus integration
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 258550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHAGE-UbiC
- Backbone size w/o insert (bp) 5165
- Total vector size (bp) 9596
-
Vector typeMammalian Expression, Lentiviral, Affinity Reagent/ Antibody
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameanti-ALFA nanobody fused with sfGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)369
- Promoter UbiC
-
Tags
/ Fusion Proteins
- GB1 (C terminal on insert)
- sfGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGAAGTTCAGATCAAGGGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.10.29.685314 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
phage UbiC ALFA-Nanobody-sfGFP-GB1 was a gift from Jeffrey Chao (Addgene plasmid # 258550 ; http://n2t.net/addgene:258550 ; RRID:Addgene_258550) -
For your References section:
Quantitative comparison of methodologies for translation site imaging in living cells. Misiaszek AD, Griesbach E, Jaugaite E, Ortale A, Eglinger J, Hochstoeger T, Chao JA. RNA. 2026 Jun 16:rna.080881.125. doi: 10.1261/rna.080881.125. 10.1261/rna.080881.125 PubMed 42303464